Infer the Functional Interpretability of a Given Structure

Input Structure: * 

Dot Bracket File Format

* Or upload a structure .ct file:
Species Under Consideration: * 
Significance level of functional interpretability: * 
Mail: (Optional)
×

Structure File Formats: dot bracket


> (Header)
(Sequence: whitespace is ignored and blank lines are not allowed)
(Structure: Unpaired nucleotides are indicated with "." To indicate pseudoknots, additional brackets may be used: [], {}, or <>.)
SAMPLE > sample
GGUGCAUGCCGAGGGGCGGUUGGCCUCGUAAAAAGCCGCAAAAAAUAGCAUGUAGUACC
((((((((((((((.[[[[[[..))))).....]]]]]]........)))))...))))