Rank the List of Predicted Structures Based on Functional Interpretability

Predicted Structures: * 

Dot Bracket File Format

* Or upload a zip file of .ct files:

CT File Format

Species Under Consideration: * 
Significance level of functional interpretability: * 
Mail: (Optional)
×

Structure File Formats: dot bracket


> (Header)
(Sequence: whitespace is ignored and blank lines are not allowed)
(Structure: Unpaired nucleotides are indicated with the "." To indicate pseudoknots, additional brackets may be used: [], {}, or <>.)

SAMPLE > sample GGUGCAUGCCGAGGGGCGGUUGGCCUCGUAAAAAGCCGCAAAAAAUAGCAUGUAGUACC
((((((((((((((.[[[[[[..))))).....]]]]]]........)))))...))))